Phương pháp PCR mới và cải tiến có thể phát hiện chính xác 100% mẫu tôm nhiễm EMS/AHPND

Viết ngày

Phương pháp PCR mới và cải tiến có thể phát hiện chính xác 100% mẫu tôm nhiễm EMS/AHPND

GS. Tim Flegel cho biết: “Tôi gửi cho bạn bản sao của một thông báo về một phương pháp PCR mới, hoàn toàn miễn phí để phát hiện chính xác 100% vi khuẩn gây bệnh EMS/AHPND. Qui trình PCR này đã được cải tiến so với qui trình PCR chúng tôi phát hành miễn phí vào tháng 12 năm 2013. Qui trình này đã được tôi công bố ở Hội nghị về tôm tại Zhanjiang, Trung Quốc vào ngày 18/06/2014“. Chi tiết qui trình PCR phát hiện EMS/AHPND
1. Ly trích DNA
DNA từ dạ dày hoặc mô gan tụy tôm, từ phân của tôm bố mẹ hay tôm post, hoặc từ tôm post (nguyên con) hoặc cua còng, giáp xác trong ao (vật lan truyền hoặc có thể mang mầm bệnh) hoặc bùn đáy ao,… được khuyến cáo thực hiện thêm một bước là “làm giàu sơ bộ” nhằm gia tăng mật số vi khuẩn bằng cách nghiền và ủ các mẫu phân tích với môi trường TSB (tryptic soy broth) có chứa 1.5% muối NaCl trong 4 giờ ở nhiệt độ 30oC với máy lắc. Sau đó để cho hỗn hợp dung dịch lắng xuống, ly tâm và loại bỏ phần dung dịch phía trên, giữ lại phần kết tủa bên dưới. DNA được ly trích từ phần mẫu kết tủa dưới đáy ống nghiệm sau khi ly tâm. Đối với mẫu vi khuẩn, có thể lấy trực tiếp khuẩn lạc để ly trích DNA. Hàm lượng DNA trong 25 µl phản ứng PCR khoảng 1 ng đối với DNA phân lập từ vi khuẩn hoặc khoảng 100 ng DNA phân lập từ mô tôm bệnh.    2. Thông tin về mồi cho phản ứng PCR (PCR primer)

Tên mồi(Primer)

Trình tự mồi (5’’-3’’)

Độ dài (bp)

%GC

Nhệt độ nóng chảy (Tm)

Nhiệt độ gắn mồi (Ta)

Sản phẩm khuếch đại (bp)

AP3-F ATGAGTAACAATATAAAACATGAAAC

26

23.08

57.63

53

336

Ap3-R GTGGTAATAGATTGTACAGAA

21

33.33

55.46

3. Thành phần phản ứng PCR

– 10X PCR mix        2.5 µl
– 50 mM MgCl2        0.7 µl
– 10 mM dNTPs        0.4 µl
– 10 µM AP3-F        0.5 µl
– 10 µM AP3-R        0.5 µl
– Tag DNA polymerase    0.2 µl

4. Chu trình PCR

– Biến tính: 94°C, 5 phút
– 30 chu kỳ bao gồm: biến tính (94°C, 30 giây); gắn mồi (53°C, 30 giây); tổng hợp (72°C, 40 giây)
– Kết thúc: 72°C, 5 phút
– Giữ ở nhiệt độ 4°C

5. Điện di

Sản phẩm khuếch đại PCR được chạy điện di trên gel agarose 2% (2 g garose/100 ml dung dịch đệm), sau đó nhuộm bằng dung dịch ethidium bromide, đọc kết quả dưới đèn UV.

6. Đọc kết quả

Mẫu dương tính với AHPND/EMS xuất hiện vạch có kích thước tương đương khoảng 336 bp, trong khi mẫu âm tính không có vạch nào xuất hiện trên gel sau khi điện di và soi dưới đèn UV.

Bạn đọc có thể đọc thêm một số thông tin liên quan về phương pháp này tại đây.

Triu Thanh Tun, www.aquanetviet.org
Source:https://www.shrimpnews.com/FreeReportsFolder/NewsReportsFolder/ThailandNewPCRDetectionMethodFlegel.

Gửi phản hồi

*